🏥 VAERS Vaccine Data Browser

🔒 Privacy & Data Disclaimer

About This Site

This is a public data browser for the Vaccine Adverse Event Reporting System (VAERS). By using this site, you acknowledge and agree to the following:

Data Source & Accuracy

Public Data: All data displayed comes from the publicly available VAERS database maintained by the CDC and FDA.
No Verification: VAERS accepts all reports without verifying medical accuracy. Reports do not prove causation between vaccines and adverse events.
Anyone Can Report: Healthcare providers, patients, family members, and anyone else can submit reports to VAERS.
Research Purpose: This data is for transparency, research, and monitoring vaccine safety signals only.

Your Privacy

No Personal Data Collection: This site does not collect, store, or track any personal information about visitors.
No Cookies: We do not use cookies except for remembering that you've seen this disclaimer (stored locally in your browser).
No Analytics: We do not use Google Analytics or any other tracking services.
Search Privacy: Your searches and filters are not logged or stored on our servers.
Public Data Only: The VAERS data shown here is already public and contains no personally identifiable information.

Medical Disclaimer

Not Medical Advice: This tool is for informational purposes only and does not provide medical advice.
Consult Healthcare Providers: Always consult qualified healthcare professionals for medical decisions.
No Liability: We are not responsible for decisions made based on this data.

Data Interpretation

The presence of a report does not mean the vaccine caused the adverse event.
Coincidental events are often reported (e.g., a heart attack that happened to occur after vaccination).
Serious adverse events must be reported by law, even if unrelated to the vaccine.
The database is useful for detecting safety signals that require further investigation.

📖 Help & Search Guide

Column Icons Legend

💀 Death

🏥 Hospitalized

🚑 Emergency Room

♿ Disability

⚠️ Life Threatening

How to Search

💡 Search Tips:

Select Year: Choose a specific year OR "All Years" to search across all data
All Years requires filters: When searching all years, you must select at least one filter (lot number, vaccine type, outcome, etc.) for performance
Lot number tracking: Use "All Years" + Lot Number to track lots across multiple years
Combine filters: Use multiple filters together to narrow results (e.g., Age + Vaccine Type + Death)
VAERS ID: Search for specific report by ID number
Age: Enter exact age (e.g., 25) or decimal (e.g., 0.5 for 6 months)
State: Enter 2-letter state code (e.g., CA, NY, TX)
Vaccine Type: Search partial names (e.g., "COVID19", "FLU", "HPV")
Manufacturer: Search by company (e.g., "PFIZER", "MODERNA")
Lot Number: Search specific vaccine lot (works great with "All Years")
Symptoms: Search for any symptom keyword (e.g., "fever", "rash")
Death/Hospitalized: Filter to only show cases with these outcomes

Understanding the Data

Reports are unverified: VAERS accepts all reports without medical verification
Not proof of causation: A report does not mean the vaccine caused the event
Anyone can report: Healthcare providers, patients, and family members can submit reports
Multiple vaccines: One report may list multiple vaccines given at the same time
Blank fields: Not all fields are required, so some data may be missing

Using the Table

Sort columns: Click column headers (ID, Age, Sex, Date, Died) to sort
Expand text: Click "More" to see full narrative or symptom text
Navigate pages: Use pagination controls at top and bottom of table
Export results: Click "📥 Export CSV" to download filtered data (max 10,000 records)

⚠️ DISCLAIMER: This data is from the Vaccine Adverse Event Reporting System (VAERS). Reports do not establish causation between vaccines and adverse events. Anyone can submit a report, and reports are not verified. This is raw data for transparency and research purposes only.

34,052

Total Reports (2025)

500

Deaths Reported

1,634

Hospitalizations

ER Visits

1,191

Disabilities

570

Life Threatening

Year: VAERS ID: Age: Sex: State: Vaccine Type: Manufacturer: Lot Number: Site: Symptom: Death: Hospitalized:

🔄 Reset 📥 Export CSV

Showing 21,501 to 21,550 of 34,052 reports (Page 431 of 682)

« First ‹ Prev 1 ... 428 429 430 431 432 433 434 ... 682 Next › Last »

ID	Age	Sex	State	Date ▼	Vaccine	Manufacturer	Lot #	Symptoms	Narrative	💀	🏥	♿	⚠️
2839010	90	M	IA	04/30/2025	COVID19	MODERNA	3046731	Death Death	Passed away Passed away	✓
2839011	73	M	GA	04/30/2025	COVID19	MODERNA	3043823	Expired product administered, No adverse event Expired product administered, No adverse event	Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient... Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient at this moment has chosen not to re-vaccinate. More
2839012	76	F	GA	04/30/2025	COVID19	MODERNA	3043823	Expired product administered, No adverse event Expired product administered, No adverse event	Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient... Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient at this moment has chosen not to re-vaccinate. More
2839013	69	M	GA	04/30/2025	COVID19	MODERNA	3043823	Expired product administered, No adverse event Expired product administered, No adverse event	Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient... Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient at this moment has chosen not to re-vaccinate. More
2839014	81	M	ME	04/30/2025	COVID19	PFIZER\BIONTECH	LP1780	Expired product administered Expired product administered	Vaccine was expired upon administration. Exp date 04/19/2025 Vaccine was expired upon administration. Exp date 04/19/2025
2839015	71	M	GA	04/30/2025	COVID19	MODERNA	3043823	Expired product administered, No adverse event Expired product administered, No adverse event	Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient... Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient at this moment has chosen not to re-vaccinate. More
2839016	42	F	SD	04/30/2025	HPV9	MERCK & CO. INC.	Y015179	Mobility decreased Mobility decreased	Patient is unable to raise their arm over 90 degrees Patient is unable to raise their arm over 90 degrees
2839017	70	F	GA	04/30/2025	COVID19	MODERNA	3043823	Expired product administered, No adverse event Expired product administered, No adverse event	Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient... Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient at this moment has chosen not to re-vaccinate. More
2839018	73	F	GA	04/30/2025	COVID19	MODERNA	3043823	Expired product administered, No adverse event Expired product administered, No adverse event	Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient... Patient was given a vaccine past its beyond use date. Patient reports no symptoms or issues. Patient at this moment has chosen not to re-vaccinate. More
2839019	22	F	MI	04/30/2025	HPV9	MERCK & CO. INC.	Y012776	Loss of consciousness Loss of consciousness	patient passed out for less than 30 seconds patient passed out for less than 30 seconds
2839020	76	M	MN	04/30/2025	COVID19	PFIZER\BIONTECH	EK4176	COVID-19, SARS-CoV-2 test positive COVID-19, SARS-CoV-2 test positive	Hospitalization related to COVID 19 following completion of primary vaccine series Hospitalization related to COVID 19 following completion of primary vaccine series		✓
2839021			OH	04/30/2025	HEPA	GLAXOSMITHKLINE BIOLOGICALS		Underdose Underdose	Maladministration of pediatric dose on adult patient; Adult use of a child product; This non-serious... Maladministration of pediatric dose on adult patient; Adult use of a child product; This non-serious case was reported by a other health professional via call center representative and described the occurrence of accidental underdose in a adult patient who received HAV (Havrix pediatric) for prophylaxis. On an unknown date, the patient received Havrix pediatric. On an unknown date, an unknown time after receiving Havrix pediatric, the patient experienced accidental underdose (Verbatim: Maladministration of pediatric dose on adult patient) and adult use of a child product (Verbatim: Adult use of a child product). The outcome of the accidental underdose and adult use of a child product were not applicable. This report is made by GSK without prejudice and does not imply any admission or liability for the incident or its consequences. Additional Information: GSK receipt date: 25-APR-2025 The vaccine service center transferred a pharmacy technician who called to ask about the dosage/schedule for ten adult patients who were maladministered pediatric doses of the Havrix vaccine. The reporter stated that the adult patients had received pediatric doses, which led to the adult use of a child product and accidental underdose. The reporter asked if there was any guidance/advice on this situation, but no vaccination date, vaccine details, or patient demographic details were provided by the pharmacy technician. No further information was provided. This was 1 of 10 linked report, reported by same reporter.; Sender's Comments: US-GSK-US2025050557:same reporter/different patient US-GSK-US2025050560:same reporter/different patient US-GSK-US2025050566:same reporter/different patient US-GSK-US2025050556:same reporter/different patient US-GSK-US2025050558:same reporter/different patient More
2839022	51	F	ME	04/30/2025	VARZOS	GLAXOSMITHKLINE BIOLOGICALS	MG5S9	Back pain, Dyspnoea, Headache, Neck pain, Pain in extremity Back pain, Dyspnoea, Headache, Neck pain, Pain in extremity	Patient provided information: Difficulty breathing, back pain, arm pain, head ache, neck pain. As of... Patient provided information: Difficulty breathing, back pain, arm pain, head ache, neck pain. As of writing this the patient is at the ED. More
2839023	19	F	VA	04/30/2025	IPV	SANOFI PASTEUR	Y1A201M	Inappropriate schedule of product administration Inappropriate schedule of product administration	Dose was given 1 month too soon. Due 5/25/25 Dose was given 1 month too soon. Due 5/25/25
2839024	56	F	MN	04/30/2025	COVID19	MODERNA	039C21A	COVID-19, SARS-CoV-2 test positive COVID-19, SARS-CoV-2 test positive	Hospitalization related to COVID 19 following completion of primary vaccine series Hospitalization related to COVID 19 following completion of primary vaccine series		✓
2839025	49	M	MI	04/30/2025	COVID19 COVID19	MODERNA MODERNA		Cardiac arrest, Cardiac assistance device user, Cardioversion, Implantable defib... Cardiac arrest, Cardiac assistance device user, Cardioversion, Implantable defibrillator insertion, Laboratory test normal; Loss of consciousness More	I am writing to report a serious cardiac event that occurred in August 2024. At that time, my heart ... I am writing to report a serious cardiac event that occurred in August 2024. At that time, my heart stopped, and I required defibrillation via an automated external defibrillator (AED). I regained consciousness en route to the hospital. Subsequent extensive testing has not identified a cause for this event, and I have since had an internal defibrillator implanted. I received the Moderna COVID-19 vaccine prior to this event and am concerned about a potential correlation between the vaccination and my cardiac arrest, particularly given discussions regarding potential cardiac issues in men my age following mRNA vaccines. I urge the FDA to investigate potential links between COVID-19 vaccines and unexplained cardiac events. I am available to provide further details about my experience if needed. Thank you for your time and attention to this important matter. More		✓		✓
2839026	64	F	CA	04/30/2025	PNC21	MERCK & CO. INC.	y019158	Injection site erythema, Injection site pain, Injection site swelling, Pyrexia Injection site erythema, Injection site pain, Injection site swelling, Pyrexia	swollen, redness, painful injection site and fever a day after the administration. patient reporte... swollen, redness, painful injection site and fever a day after the administration. patient reported possible cellulitis and treatment at urgent care with an injection of steroid or antibiotic. Patient is not sure if patient recieved antibiotic or steroid injection at urgent care but it help reduce injection site reaction. More
2839027	74	F	MT	04/30/2025	COVID19	PFIZER\BIONTECH	LP1776	Expired product administered, No adverse event Expired product administered, No adverse event	Given 3 days beyond expiration date. No adverse reactions reports. Given 3 days beyond expiration date. No adverse reactions reports.
2839028	81	F	OH	04/30/2025	PNC20	PFIZER\WYETH	LN4927	Palpitations, Peripheral swelling, Rash, Vision blurred Palpitations, Peripheral swelling, Rash, Vision blurred	5 days after vaccine, pt had heart palpitations and blurred vision. The next day she had swelling an... 5 days after vaccine, pt had heart palpitations and blurred vision. The next day she had swelling and rash in the arm. @ days after that it was gone. More
2839029	19	M	CA	04/30/2025	ANTH JEV1 TYP	EMERGENT BIOSOLUTIONS INTERCELL AG SANOFI PASTEUR	300216A JEV23K06E X1A271M	Face injury, Fall, Laboratory test normal, Loss of consciousness; Face injury, F... Face injury, Fall, Laboratory test normal, Loss of consciousness; Face injury, Fall, Laboratory test normal, Loss of consciousness; Face injury, Fall, Laboratory test normal, Loss of consciousness More	As the patient was receiving his oversea shots at 8:57 am he passed out and fell face flat into the ... As the patient was receiving his oversea shots at 8:57 am he passed out and fell face flat into the ground in front of him from the sitting position. We proceeded to sternum rub him and pick him up to lay him down on the gurney. where he woke up after being out for 3 seconds at 8:58 am, He was seen by a provider and cleared of any TBI. More
2839030	0.75	F	KY	04/30/2025	MMR	MERCK & CO. INC.	Y014391	Urticaria Urticaria	Hives on face, arm, leg and buttocks within 5 minutes of receiving vaccine. Benadryl 3/4 tsp, decadr... Hives on face, arm, leg and buttocks within 5 minutes of receiving vaccine. Benadryl 3/4 tsp, decadron 4mg administered orally in office and topical steroid applied. Patient observed for 40 minutes in the office and cleared to leave by Dr. More
2839031	35	F	IL	04/30/2025	COVID19 COVID19	PFIZER\BIONTECH PFIZER\BIONTECH		Condition aggravated, Fatigue, Genital herpes, Headache, Herpes simplex; Migrain... Condition aggravated, Fatigue, Genital herpes, Headache, Herpes simplex; Migraine, Myalgia, Oral herpes, SARS-CoV-2 antibody test positive More	Chronic low grade to moderate fatigue. A increase in headaches and now having migraines. Muscle sore... Chronic low grade to moderate fatigue. A increase in headaches and now having migraines. Muscle soreness. An increase in herpes outbreaks (3+ times a year now) as well as the herpes sores presenting in a different location both on my lip and genital region. A possibility that I have heavier bleeding during my menstrual cycle since the immunization, however I am not positive that is resulting from the shot. More
2839032	59	M	MN	04/30/2025	VARZOS	GLAXOSMITHKLINE BIOLOGICALS	A5T73	Injection site erythema, Injection site induration, Injection site swelling Injection site erythema, Injection site induration, Injection site swelling	Patient's wife called on 4/30/25 to report patient's reaction to his Shingrix shot given o... Patient's wife called on 4/30/25 to report patient's reaction to his Shingrix shot given on 4/28/25. He has ~2 inch diameter red, raised, hard area where the vaccine was injected (right deltoid). No difficulties breathing, no rash/hives. More
2839033	78	F	MI	04/30/2025	COVID19	PFIZER\BIONTECH	MD3414	Blindness unilateral, Vision blurred Blindness unilateral, Vision blurred	The patient has experienced loss of vision in their right eye. She describes it as white, fuzzy, or... The patient has experienced loss of vision in their right eye. She describes it as white, fuzzy, or lines through it. She's seen an eye doctor who says it isn't retinal, but they are going to explore more concerns. With post market reporting for the vaccine showing optical adverse events, I thought there's a chance this could be related to the Comirnaty injection. More
2839034	60	F	CA	04/30/2025	VARZOS VARZOS	GLAXOSMITHKLINE BIOLOGICALS GLAXOSMITHKLINE BIOLOGICALS		Asthenia, Chills, Fatigue, Headache, Injection site pain; Myalgia, Nausea Asthenia, Chills, Fatigue, Headache, Injection site pain; Myalgia, Nausea	chills headache muscular pain and fatigue. no energy and pain at the injection site, some nausea chills headache muscular pain and fatigue. no energy and pain at the injection site, some nausea
2839035	11	F	PA	04/30/2025	IPV TDAP	SANOFI PASTEUR GLAXOSMITHKLINE BIOLOGICALS	X1C891M LK59T	Inappropriate schedule of product administration, No adverse event; Inappropriat... Inappropriate schedule of product administration, No adverse event; Inappropriate schedule of product administration, No adverse event More	Vaccine given 14 days too soon. No adverse reaction. Vaccine given 14 days too soon. No adverse reaction.
2839036	5	F	NM	04/30/2025	DTAPIPV HEPA MMRV	GLAXOSMITHKLINE BIOLOGICALS GLAXOSMITHKLINE BIOLOGICALS MERCK & CO. INC.	42Y93 C24B9 Y017511	Asthma, Condition aggravated; Asthma, Condition aggravated; Asthma, Condition ag... Asthma, Condition aggravated; Asthma, Condition aggravated; Asthma, Condition aggravated More	Child developed an asthma exacerbation the day after the vaccine administration and was seen in the ... Child developed an asthma exacerbation the day after the vaccine administration and was seen in the ER, prescribed albuterol. Parent reports a history of asthma flare ups after vaccine administration when she was an infant as well. More
2839037			OH	04/30/2025	HEPA	GLAXOSMITHKLINE BIOLOGICALS		Underdose Underdose	Maladministration of pediatric dose on adult patient; Maladministration of pediatric dose on adult p... Maladministration of pediatric dose on adult patient; Maladministration of pediatric dose on adult patient; This non-serious case was reported by a other health professional via call center representative and described the occurrence of adult use of a child product in a adult patient who received HAV (Havrix pediatric) for prophylaxis. On an unknown date, the patient received Havrix pediatric. On an unknown date, an unknown time after receiving Havrix pediatric, the patient experienced adult use of a child product (Verbatim: Maladministration of pediatric dose on adult patient) and accidental underdose (Verbatim: Maladministration of pediatric dose on adult patient). The outcome of the adult use of a child product and accidental underdose were not applicable. This report is made by GSK without prejudice and does not imply any admission or liability for the incident or its consequences. Additional Information: GSK receipt date: 25-APR-2025 The vaccine service center transferred a pharmacy technician who called to ask about the dosage/schedule for ten adult patients who were maladministered pediatric doses of the Havrix vaccine. The reporter stated that the adult patients had received pediatric doses, which led to the adult use of a child product and accidental underdose. The reporter asked if there was any guidance/advice on this situation, but no vaccination date, vaccine details, or patient demographic details were provided by the pharmacy technician. No further information was provided. This was 1 of 10 linked report, reported by same reporter.; Sender's Comments: US-GSK-US2025050560:same reporter/different patient US-GSK-US2025050557:same reporter/different patient US-GSK-US2025050563:same reporter/different patient US-GSK-US2025050561:same reporter/different patient US-GSK-US2025050559:same reporter/different patient US-GSK-US2025050556:same reporter/different patient US-GSK-US2025050553:same reporter/different patient US-GSK-US2025050551:same reporter/different patient US-GSK-US2025050558:same reporter/different patient More
2839038	1.08	F	MO	04/30/2025	MMR MMRV VARCEL	MERCK & CO. INC. MERCK & CO. INC. MERCK & CO. INC.	Y007623 Y012077 Y010045	Extra dose administered; Extra dose administered; Extra dose administered Extra dose administered; Extra dose administered; Extra dose administered	None None
2839039	6	F	PA	04/30/2025	DTAP	GLAXOSMITHKLINE BIOLOGICALS	9PT2F	Inappropriate schedule of product administration Inappropriate schedule of product administration	Given too soon Given too soon
2839040	61	F	NC	04/30/2025	PNC21 PNC21	MERCK & CO. INC. MERCK & CO. INC.	Z002626 Z002626	Chills, Diarrhoea, Injection site inflammation, Injection site rash, Pyrexia; Ra... Chills, Diarrhoea, Injection site inflammation, Injection site rash, Pyrexia; Rash erythematous More	Patient developed a rash after the injection below site. Rash was described as very red and inflamed... Patient developed a rash after the injection below site. Rash was described as very red and inflamed. Patient also experienced chills, fever, and diarrhea. More
2839041	40	F	NJ	04/30/2025	COVID19 COVID19 COVID19	MODERNA MODERNA MODERNA	072L20A 072L20A 072L20A	Arthralgia, Brain fog, Chronic obstructive pulmonary disease, Computerised tomog... Arthralgia, Brain fog, Chronic obstructive pulmonary disease, Computerised tomogram abnormal, Computerised tomogram head; Dyspnoea, Fatigue, Generalised oedema, Paranasal sinus polypectomy, Sinuplasty; Sinus polyp, Sinusitis, Skin disorder, Type 1 diabetes mellitus, Wheezing More	Skin issue, difficulty breathing, joint pain, generalized edema, fatigue brain fog, sinusitis, wheez... Skin issue, difficulty breathing, joint pain, generalized edema, fatigue brain fog, sinusitis, wheezing, COPD, Insulin dependent diabetes More			✓
2839042	0.58	M	MI	04/30/2025	RV1 RV1 RV1 RV1	GLAXOSMITHKLINE BIOLOGICALS GLAXOSMITHKLINE BIOLOGICALS GLAXOSMITHKLINE BIOLOGICALS GLAXOSMITHKLINE BIOLOGICALS	EX434 EX434 ex434 ex434	Extra dose administered; Extra dose administered; Extra dose administered; Extra... Extra dose administered; Extra dose administered; Extra dose administered; Extra dose administered More	patient was given a third dose of rotovirus in error patient was given a third dose of rotovirus in error
2839043	78	F	MI	04/30/2025	COVID19 COVID19	PFIZER\BIONTECH PFIZER\BIONTECH	lm7786 lm7786	Body temperature increased, COVID-19, Cellulitis, SARS-CoV-2 test positive, Vomi... Body temperature increased, COVID-19, Cellulitis, SARS-CoV-2 test positive, Vomiting; White blood cell count increased More	Patient developed vomiting and increased temp, was transferred to hospital r/t acute change in condi... Patient developed vomiting and increased temp, was transferred to hospital r/t acute change in condition and tested positive for covid at the hospital More		✓
2839044	78	M	NM	04/30/2025	COVID19	PFIZER\BIONTECH	FR8734	Asthenia, Dizziness, Fatigue Asthenia, Dizziness, Fatigue	Chronic Fatigue; Lack of energy; Dizziness. No treatments given or recommended. Chronic Fatigue; Lack of energy; Dizziness. No treatments given or recommended.
2839045	81	M	MA	04/30/2025	FLU3	SANOFI PASTEUR		Acoustic stimulation tests, Computerised tomogram, Deafness unilateral Acoustic stimulation tests, Computerised tomogram, Deafness unilateral	Loss of hearing left ear Loss of hearing left ear			✓
2839046	66	F	NC	04/30/2025	COVID19 PNC21	PFIZER\BIONTECH MERCK & CO. INC.	LP1780 Y011819	Injected limb mobility decreased, Injection site nerve damage, Muscular weakness... Injected limb mobility decreased, Injection site nerve damage, Muscular weakness; Injected limb mobility decreased, Injection site nerve damage, Muscular weakness More	Patient states that when vaccine was administered the needle "hit a nerve" and consequentl... Patient states that when vaccine was administered the needle "hit a nerve" and consequently she has had issues with mobility and strength in her left arm. More
2839047	65	F	MN	04/30/2025	MNQ	SANOFI PASTEUR	U8375AA	Erythema, Peripheral swelling, Pruritus Erythema, Peripheral swelling, Pruritus	Evening of vaccination, her left arm became red and swollen from the shoulder through the wrist. The... Evening of vaccination, her left arm became red and swollen from the shoulder through the wrist. The next day it was itchy as well. Came into clinic 4/30/2025 to show RN/MD. It has been improving since then, but there remains areas of raised, red, pruritic rash. Areas include the left deltoid area, posterior to shoulder, anterior upper arm, and an area in the back right lateral to the spine and medial to the shoulder. Reports no fevers and no other symptoms. Feeling fine otherwise. More
2839048	52	F	WA	04/30/2025	VARZOS	GLAXOSMITHKLINE BIOLOGICALS	H97H2	Injection site erythema, Injection site pain, Pyrexia Injection site erythema, Injection site pain, Pyrexia	Patient was having fever the night after having the vaccines and it was gone by the time patient rep... Patient was having fever the night after having the vaccines and it was gone by the time patient reports the adverse events. It was a localized red patch around the injection and then it get bigger and bigger but not just remained localized around the injection site. Patient also reports some pain. Recommended Bendery, hydrocortisone cream and if not getting better or the redness radiate to the rest of body or the other arm, recommend to ER to urgent care for some prednisone but not SOB reported. More
2839049	58	F	CO	04/30/2025	COVID19 COVID19 COVID19 COVID19 COVID19 COVID19	MODERNA MODERNA MODERNA MODERNA MODERNA MODERNA	016B21A 016B21A 016B21A 021C21A 021C21A 021C21A	Atelectasis, Back pain, Chest X-ray normal, Chest discomfort, Computerised tomog... Atelectasis, Back pain, Chest X-ray normal, Chest discomfort, Computerised tomogram thorax abnormal; Condition aggravated, Cough, Dyspnoea, Malaise, Pulmonary embolism; Scan with contrast abnormal, Sleep disorder, Tachycardia; Atelectasis, Back pain, Chest X-ray normal, Chest discomfort, Computerised tomogram thorax abnormal; Condition aggravated, Cough, Dyspnoea, Malaise, Pulmonary embolism; Scan with contrast abnormal, Sleep disorder, Tachycardia More	After my second injection my shortness of breath really increased, had to be put on home oxygen, I a... After my second injection my shortness of breath really increased, had to be put on home oxygen, I also developed tachycardia. I had made 3 trips to the ER Because I was so short of breath. At approximately 6/25/21 I had developed a 100 degree fever with pain in my lower back rt side. I also felt bubbling and rubbing in my lower lungs. It was so painful that I could only sleep on my side. I felt that something was really wrong. I messaged my Dr twice. All she did was order a plain Xray of my chest in her office, it was normal. She didn't do any more, I was disappointed and worried. By 11 pm 7/1/21 I was so sick, coughing alot too, I drove myself to the ER. More			✓
2839050	0.17	F	WA	04/30/2025	DTAP HEP HIBV IPV PNC20 RV1	SANOFI PASTEUR GLAXOSMITHKLINE BIOLOGICALS GLAXOSMITHKLINE BIOLOGICALS SANOFI PASTEUR PFIZER\WYETH GLAXOSMITHKLINE BIOLOGICALS		Crying, Discomfort, Encephalitis, Pain; Crying, Discomfort, Encephalitis, Pain; ... Crying, Discomfort, Encephalitis, Pain; Crying, Discomfort, Encephalitis, Pain; Crying, Discomfort, Encephalitis, Pain; Crying, Discomfort, Encephalitis, Pain; Crying, Discomfort, Encephalitis, Pain; Crying, Discomfort, Encephalitis, Pain More	At roughly 3 hours after the shot, our child began showing signs of discomfort. The child began to i... At roughly 3 hours after the shot, our child began showing signs of discomfort. The child began to intensely cry uncontrollable for 3+ hours. We were unable to calm her down due to encephalitis. We called our primary care provider, and they recommend Tylenol. This medicine knocked her out for about 6 hours until she woke up crying again. We had to administer additional tylenol to control the pain for the child. More			✓
2839051	0.17	F	NE	04/30/2025	DTAPIPVHIB HEP PNC20 RV5	SANOFI PASTEUR GLAXOSMITHKLINE BIOLOGICALS PFIZER\WYETH MERCK & CO. INC.	UK199AA 4D333 LK6651 2117042	Cyanosis, Staring, Vomiting projectile; Cyanosis, Staring, Vomiting projectile; ... Cyanosis, Staring, Vomiting projectile; Cyanosis, Staring, Vomiting projectile; Cyanosis, Staring, Vomiting projectile; Cyanosis, Staring, Vomiting projectile More	Per patient's mother at 1955 patient was taking her famotidine and projectile vomited. Followin... Per patient's mother at 1955 patient was taking her famotidine and projectile vomited. Following that patient's lips and around mouth were a bluish/purple color. Patient then began to have bubbles come out of her mouth and had a "blank stare." Per mother reported that patient then was not tracking or responding for approximately 2 minutes following episode. More
2839052	57	F	OH	04/30/2025	COVID19 UNK UNK	UNKNOWN MANUFACTURER UNKNOWN MANUFACTURER UNKNOWN MANUFACTURER		Arthralgia, Injected limb mobility decreased, Myalgia, Pain in extremity; Arthra... Arthralgia, Injected limb mobility decreased, Myalgia, Pain in extremity; Arthralgia, Injected limb mobility decreased, Myalgia, Pain in extremity; Arthralgia, Injected limb mobility decreased, Myalgia, Pain in extremity More	I pain in arms a little after 24 muscle joint area pain, and began to spread towards my elbow today ... I pain in arms a little after 24 muscle joint area pain, and began to spread towards my elbow today and i went to open a door and i noticed it was painful which was my left which i got the Covid and flu shot in. Yesterday i couldn't use the other arm so it changed sides. Today as well i am having issues with neck More
2839053	83	F	NH	04/30/2025	COVID19	MODERNA	8081260	Expired product administered, No adverse event Expired product administered, No adverse event	no adverse event. Vaccine administered was 3 days beyond the beyond use date. no adverse event. Vaccine administered was 3 days beyond the beyond use date.
2839054	64	F		04/30/2025	TDAP VARZOS	SANOFI PASTEUR GLAXOSMITHKLINE BIOLOGICALS	U8115AA MG5S9	Injection site erythema, Injection site swelling, Injection site warmth, Pain in... Injection site erythema, Injection site swelling, Injection site warmth, Pain in extremity, Pyrexia; Injection site erythema, Injection site swelling, Injection site warmth, Pain in extremity, Pyrexia More	Patient complains of severe pain in both arms, her right arm shows signs of injection site reaction ... Patient complains of severe pain in both arms, her right arm shows signs of injection site reaction with mild redness that was reportedly much more swollen, red, and hot a couple of days previous to today. She says that she is still experiencing fever at night. She was referred to her pcp for follow up. More
2839055			PA	04/30/2025	MMR	GLAXOSMITHKLINE BIOLOGICALS		Product preparation error Product preparation error	seems that they may use the Shingrix diluent for the Priorix lyoph powder; vaccines where given with... seems that they may use the Shingrix diluent for the Priorix lyoph powder; vaccines where given without the diluent; This non-serious case was reported by a pharmacist via call center representative and described the occurrence of wrong solution used in drug reconstitution in specified number of patient who received MMR (Priorix) for prophylaxis. On an unknown date, the patient received Priorix. On an unknown date, an unknown time after receiving Priorix, the patient experienced wrong solution used in drug reconstitution (Verbatim: seems that they may use the Shingrix diluent for the Priorix lyoph powder) and inappropriate dose of vaccine administered (Verbatim: vaccines where given without the diluent). The outcome of the wrong solution used in drug reconstitution and inappropriate dose of vaccine administered were not applicable. This report is made by GSK without prejudice and does not imply any admission or liability for the incident or its consequences. Additional Information: GSK receipt date: 24-APR-2025 Other HCP reported that they had 2 situation which the diluent was not use to diluent the injection. Reporter stated that they had in the inventory 2 Priorix diluents left alone, so that's why they assume the Priorix vaccines were given without the diluent. Also, indicated that they also had the Shingrix vaccine, so due to this, it seems that they may use the Shingrix diluent for the Priorix lyoph. powder, HCP did not confirmed this. Priorix reconstituted with diluent of Shingrix instead of the supplied liquid conjugate, which led to wrong solution used in drug reconstitution and inappropriate dose of vaccine administered. More
2839056		F	FL	04/30/2025	HEP	GLAXOSMITHKLINE BIOLOGICALS	T5P73	Underdose Underdose	Maladministration of Adult Dose on an Pediatric Patient; Adult Dose on an Pediatric Patient; This no... Maladministration of Adult Dose on an Pediatric Patient; Adult Dose on an Pediatric Patient; This non-serious case was reported by a pharmacist via call center representative and described the occurrence of adult product administered to child in a 17-year-old female patient who received HBV (Engerix B) (batch number T5P73, expiry date 10-APR-2027) for prophylaxis. On 20-MAR-2025, the patient received Engerix B. On 20-MAR-2025, an unknown time after receiving Engerix B, the patient experienced adult product administered to child (Verbatim: Maladministration of Adult Dose on an Pediatric Patient) and overdose (Verbatim: Adult Dose on an Pediatric Patient). The outcome of the adult product administered to child and overdose were not applicable. This report is made by GSK without prejudice and does not imply any admission or liability for the incident or its consequences. Additional Information: GSK Receipt Date: 28-APR-2025 The pharmacist called to ask about guidance/safety concerns because a pediatric patient seventeen year old was administered with an adult dose, which led to adult product administered to child and overdose. The Vaccine Administration Facility is the same as Primary Reporter. More
2839057			TX	04/30/2025	MNQ	NOVARTIS VACCINES AND DIAGNOSTICS	UNK	Product preparation issue Product preparation issue	Menveo - Only diluent administered; Menveo - Only diluent administered; This non-serious case was re... Menveo - Only diluent administered; Menveo - Only diluent administered; This non-serious case was reported by a pharmacist via call center representative and described the occurrence of inappropriate preparation of medication in a patient who received Men ACWY-CRM NVS (Menveo) for prophylaxis. On an unknown date, the patient received Menveo. On an unknown date, an unknown time after receiving Menveo, the patient experienced inappropriate preparation of medication (Verbatim: Menveo - Only diluent administered) and inappropriate dose of vaccine administered (Verbatim: Menveo - Only diluent administered). The outcome of the inappropriate preparation of medication and inappropriate dose of vaccine administered were not applicable. Additional Information: GSK Receipt Date: 28-APR-2025 The pharmacist stated that they had found a vial of the A component of Menveo (2 vials) in their fridge. As a result, they assumed that one of the five patients had only received the diluent portion of the vaccine, which led to Inappropriate preparation of medication and Inappropriate dose of vaccine administered. The pharmacist mentioned that a physician had been considering re-vaccinating all five patients, but the pharmacist had been uncertain about this decision. The pharmacist had inquired about how soon the dose could be repeated. More
2839058	65	F	PA	04/30/2025	VARZOS	GLAXOSMITHKLINE BIOLOGICALS	7349L	Extra dose administered Extra dose administered	3rd dose administered.; This non-serious case was reported by a other health professional via call c... 3rd dose administered.; This non-serious case was reported by a other health professional via call center representative and described the occurrence of extra dose administered in a 65-year-old female patient who received Herpes zoster (Shingrix) (batch number 7349L, expiry date 25-MAR-2027) for prophylaxis. Previously administered products included Shingrix (received first dose of Shingrix in December 2021) and Shingrix (received second dose of Shingrix in February 2022). On 28-APR-2025, the patient received the 3rd dose of Shingrix. On 28-APR-2025, an unknown time after receiving Shingrix, the patient experienced extra dose administered (Verbatim: 3rd dose administered.). The outcome of the extra dose administered was not applicable. Additional Information: GSK Receipt Date: 28-APR-2025 The nurse reported that he/she just gave a patient a Shingrix vaccine, however it was her third one which led ot extra dose administered, the other one was given in December of 2021, the second (dose) was on February of 2022.. More
2839059	37	F	MA	04/30/2025	COVID19 COVID19 COVID19 COVID19	MODERNA MODERNA MODERNA MODERNA		Aspiration bone marrow, Biopsy bone marrow, Blood folate, COVID-19, Electrophore... Aspiration bone marrow, Biopsy bone marrow, Blood folate, COVID-19, Electrophoresis; Flow cytometry, Gene mutation, Gene sequencing, Haemoglobin, Hypogammaglobulinaemia; Immunophenotyping, Mean cell volume, Natural killer cell count, Sideroblastic anaemia, T-lymphocyte count; Vitamin B12 More	hypogammaglobulinemia; LIG1 deficiency that presented with macrocytic sideroblastic anemia; LIG1 def... hypogammaglobulinemia; LIG1 deficiency that presented with macrocytic sideroblastic anemia; LIG1 deficiency that presented with macrocytic sideroblastic anemia; Patient developed SARS-CoV-2 infection 1 year after completing the primary series; This literature-non-study case was reported in a literature article and describes the occurrence of HYPOGAMMAGLOBULINAEMIA (hypogammaglobulinemia) in a 37-year-old female patient who received SPIKEVAX NOS (SPIKEVAX NOS) for COVID-19 prophylaxis. The occurrence of additional non-serious events is detailed below. LITERATURE REFERENCE: The patient's past medical history included Lung infection (recurrent sinopulmonary infections as a child), Sinus infection (recurrent sinopulmonary infections as a child), Community acquired pneumonia (several hospitalizations), Seizure (several hospitalizations), Asthma (several hospitalizations for moderate-persistent asthma), Obstructive sleep apnea (several hospitalizations for mild obstructive sleep apnea) and Attention deficit hyperactivity disorder (several hospitalizations). Family history included Myelitis transverse (mother died at age 64 from complications related to transverse myelitis). Concurrent medical conditions included Macrocytic anemia (long-standing history of a mild underproduction macrocytic anemia). On an unknown date, the patient received dose of SPIKEVAX NOS (SPIKEVAX NOS) (unknown route) 1 dosage form. On an unknown date, after starting SPIKEVAX NOS (SPIKEVAX NOS), the patient experienced HYPOGAMMAGLOBULINAEMIA (hypogammaglobulinemia) (seriousness criterion medically significant), SIDEROBLASTIC ANAEMIA (LIG1 deficiency that presented with macrocytic sideroblastic anemia), GENE MUTATION (LIG1 deficiency that presented with macrocytic sideroblastic anemia) and COVID-19 (Patient developed SARS-CoV-2 infection 1 year after completing the primary series). The patient was treated with Immunoglobulin human normal (Immunoglobulin) at an unspecified dose and frequency. At the time of the report, HYPOGAMMAGLOBULINAEMIA (hypogammaglobulinemia), SIDEROBLASTIC ANAEMIA (LIG1 deficiency that presented with macrocytic sideroblastic anemia) and GENE MUTATION (LIG1 deficiency that presented with macrocytic sideroblastic anemia) outcome was unknown and COVID-19 (Patient developed SARS-CoV-2 infection 1 year after completing the primary series) had resolved. DIAGNOSTIC RESULTS (normal ranges are provided in parenthesis if available): On an unknown date, Aspiration bone marrow: normocellular marrow for age with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.6:1) associated with dyserythropoiesis in a subset of erythroids, including nuclear irregularities, binucleation, and budding, as well as megaloblastic maturation. Iron stain revealed >?15% ring sideroblasts.. On an unknown date, Biopsy bone marrow: normocellular marrow for age with a relative erythroid hyperplasia (myeloid to erythroid ratio of 0.6:1) associated with dyserythropoiesis in a subset of erythroids, including nuclear irregularities, binucleation, and budding, as well as megaloblastic maturation. Iron stain revealed >?15% ring sideroblasts.. On an unknown date, Blood folate: normal. On an unknown date, Electrophoresis: To confirm that the c.776+5G>T allele impacts splicing, reverse transcriptase polymerase chain reaction (RT-PCR) primers (LIG1_F: CAGGAGGAGGAAGAGCAGAC; LIG1_R: CAGGCATCTTCCACGGGAT) spanning the splice junction between exon 9 and 10 was performed. Agarose gel electrophoresis of RT-PCR amplicons showed a larger splicing product. Next-generation sequencing of this amplicon identified a 16-base pair insertion in transcripts derived from the c.776+5G>T allele (c.776ins16) predicted to result in a frameshift and termination present in 36% of the reads. It was unclear if this decreased transcript abundance was secondary to reduced efficiency of splicing at the normal splice donor site or nonsense-mediated decay of the aberrantly spliced mRNA. Whatever the mechanism, this finding supports\ed the notion that the c.776+5G>T allele was a genetic hypomorph.. On an unknown date, Flow cytometry: Flow cytometry on the marrow identified no abnormal myeloid, B, or T cell populations, and routine karyotype was 46, XX.. On an unknown date, Gene sequencing: (Negative) Clinical ALAS2 sequencing and In whole exome sequencing patient was found to have compound heterozygous LIG1 mutations (c.1922G>T, p.R641L and c.776+5G>T, NM_000234.3) that were confirmed to be in trans by PacBio long-range genomic sequencing.. On an unknown date, Haemoglobin: 11.6 gram per litre. On an unknown date, Immunophenotyping: Immunophenotyping showed mildly reduced CD19+ B cells, normal numbers of CD27+ memory B cells, and reduced immunoglobulin (Ig) class-switching with low IgM/IgD memory cells and virtual absence of IgA+ and IgG+ class switched memory B cells.. On an unknown date, Mean cell volume: 125 fL. On an unknown date, Natural killer cell count: Normal. On an unknown date, T-lymphocyte count: T cell was Normal. On an unknown date, Vitamin B12: Normal. For SPIKEVAX NOS (SPIKEVAX NOS) (Unknown), the reporter did not provide any causality assessments. Concomitant medications were not reported. The patient's full brother and 2 maternal half-sisters are healthy. Vaccination titers were protective for only 3 of 23 pneumococcal serotypes. T and NK cell numbers were normal, and response to mitogen stimulation with phytohemagglutinin and CD3 was normal. The patient was started on replacement immunoglobulin. She developed SARS-CoV-2 infection 1?year after completing the primary series of the mRNA-1273 vaccine and was successfully managed with antiviral therapy as an outpatient. This was first reported case of LIG1 deficiency diagnosed in an adult patient. Patient had mild clinical phenotypes. Patient harbored one missense variant that results in reduced LIG1 activity and a splice site variant, which may allow for some residual wild-type enzyme activity, accounting for the relatively mild clinical presentations. This report broadens the clinical spectrum of LIG1 deficiency and highlights the increasing awareness that inborn errors of immunity may manifest with a wide range of immunological features and varying degrees of disease severity. As the immune deficiency can be subtle, LIG1 deficiency should be considered in the differential diagnosis of patients presenting to hematologists with macrocytic sideroblastic anemia. Patient did not show evidence of excessive somatic heteroplasmic mitochondrial DNA variants, which argues against a major impact of LIG1 deficiency on mitochondrial DNA replication and repair.; Reporter's Comments: Long-standing history of macrocytic anemia remains as a confounder for sideroblastic anaemia. The benefit-risk relationship of product is not affected by this report. More

‹ Previous Page 431 of 682 Next ›

🏥 VAERS Vaccine Data Browser

🔒 Privacy & Data Disclaimer

About This Site

Data Source & Accuracy

Your Privacy

Medical Disclaimer

Data Interpretation

📖 Help & Search Guide

Column Icons Legend

How to Search

Understanding the Data

Using the Table

💡 Frequently Asked Questions (FAQ)

What is this site?

What is VAERS?

Is this data HIPAA compliant?

Why does this site exist?

Where does the data come from?

My vaccine lot number matches one with deaths/serious events - should I be worried?

Can I trust VAERS data?

What are "adverse events"?

Why are some lot numbers listed multiple times?

How often is this data updated?

Where can I learn more?